ruminococcus flavefaciens atcc 19208 t ggacgataatgacggtactt gcaatcygaactgggacaat (ATCC)
Structured Review

Ruminococcus Flavefaciens Atcc 19208 T Ggacgataatgacggtactt Gcaatcygaactgggacaat, supplied by ATCC, used in various techniques. Bioz Stars score: 90/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ruminococcus flavefaciens atcc 19208 t ggacgataatgacggtactt gcaatcygaactgggacaat/product/ATCC
Average 90 stars, based on 5 article reviews
Images
1) Product Images from "Diet-Dependent Shifts in the Bacterial Population of the Rumen Revealed with Real-Time PCR"
Article Title: Diet-Dependent Shifts in the Bacterial Population of the Rumen Revealed with Real-Time PCR
Journal:
doi: 10.1128/AEM.67.6.2766-2774.2001
Figure Legend Snippet: PCR primers for detection of rumen bacteria
Techniques Used: